Methods: A small sample of subjects (n=40)between the ages of 18-83 years constituted the research sample. Subgingival plaque was collected and spotted onto nitrocellulose membranes, fixed at 80°C for 2 hours and stored till further use. A PCR-amplified DNA probe was constructed using the following HCMV primers: forward -5'TTGCAGGCCAACAACGT 3', reverse- 5' GTCTACGGATTGCTGACGCT 3'. The probe was labelled using the Digoxigenin DNA labelling kit (Roche Diagnostics)and dot-blot hybridisation detected by a colour change in the membrane spots. Serial dilutions of Human Cytomegalovirus DNA served as a positive control.
Results: Although the positive control yielded very good results, Cytomegalovirus was not detected in any of the clinical samples, many of which had demonstrated high numbers of bacterial periodontopathogens such as spirochaetes and motile rods by microscopy.
Conclusion: The absence of Human Cytomegalovirus in this sample may explain why the gingivitis observed in this community does not progress to periodontitis. However, because of the small sample size, further studies are needed to confirm this.