IADR Abstract Archives

Detection of Cytomegalovirus in Plaque Samples by in situ Hybridisation

Objectives: Recent studies have implicated Herpes viruses in the aetiology of periodontitis and suggest that these viruses contribute more strongly to the pathogenesis of periodontitis than anaerobic bacteria. The objective of this study was to examine plaque samples from subjects who appeared to have a "contained" gingivitis for the presence of Cytomegalovirus , the Herpes virus most frequently associated with periodontal disease.

Methods: A small sample of subjects (n=40)between the ages of 18-83 years constituted the research sample. Subgingival plaque was collected and spotted onto nitrocellulose membranes, fixed at 80°C for 2 hours and stored till further use. A PCR-amplified DNA probe was constructed using the following HCMV primers: forward -5'TTGCAGGCCAACAACGT 3', reverse- 5' GTCTACGGATTGCTGACGCT 3'. The probe was labelled using the Digoxigenin DNA labelling kit (Roche Diagnostics)and dot-blot hybridisation detected by a colour change in the membrane spots. Serial dilutions of Human Cytomegalovirus DNA served as a positive control.

Results: Although the positive control yielded very good results, Cytomegalovirus was not detected in any of the clinical samples, many of which had demonstrated high numbers of bacterial periodontopathogens such as spirochaetes and motile rods by microscopy.

Conclusion: The absence of Human Cytomegalovirus in this sample may explain why the gingivitis observed in this community does not progress to periodontitis. However, because of the small sample size, further studies are needed to confirm this.


Division: South African Division
Meeting: 2006 South African Division (Midrand, South Africa)
Location: Midrand, South Africa
Year: 2006
Final Presentation ID:
Abstract Category|Abstract Category(s): Scientific Groups
Authors
  • Adams, John-clint  ( Nelson Madela School of Medicine, N/A, N/A, South Africa )
  • Africa, Charlene  ( University of Western Cape, Bellville, Cape Town, N/A, South Africa )
  • SESSION INFORMATION
    Oral Session
    Microbiology/Immunology/Infection Control