Salivary Fusobacterium nucleatum as a Potential Source of Nasopharyngeal F. nucleatum During Acute Otitis Media in Infancy

Objectives: During respiratory infection environmental and ecological changes in infants' nasopharynges favor the growth of anaerobic bacteria. They can be frequently recovered from nasopharyngeal aspirates during acute otitis media (AOM) episodes in infancy, Fusobacterium nucleatum (F.n.) and saccharolytic Prevotella spp. being the most common anaerobic findings. Since the oral cavity is the most plausible source and saliva the most plausible vehicle for nasopharyngeal anaerobes, the aim of the present study was to assess the clonal similarity between nasopharyngeal and salivary anaerobic bacterial isolates using F.n. as a representative. Methods: Eleven F.n. nasopharyngeal isolates collected through the nasal cavity during AOM episodes and 161 salivary F.n. isolates preceding and after AOM from eight infants were available for arbitrarily primed-PCR (AP-PCR) fingerprinting. AP-PCR was performed using the C1 (GATGAGTTCGTGTCCGTACAACTGG) and C2 (GGTTATCGAAATCAGCCACAGCGCC) primers, which previously have been used for typing F.n. strains. DNA was isolated by boiling in chelating resin suspension for 10 min followed by a brief vortexing and centrifugation for 10 min. The PCR was performed in a 25 µl volume in a 500 µl PCR tube containing 5µl of the DNA suspension and 0.8 mM of either primer. Amplified products were separated by agarose gel electrophoresis, stained with ethidium bromide, and photographed digitally. Results: Oral F.n. clones seemed unstable throughout the sampling periods: the infants harbored up to four AP-PCR clonal types at a given time, which usually were not found in next samplings 6 months later. In five out of eight infants nasopharyngeal and salivary isolates shared identical AP-PCR pattern. Conclusions: Our results indicate that nasopharyngeal F.n. during AOM originates from the oral cavity.